Review



pcsk9  (Boster Bio)


Bioz Verified Symbol Boster Bio is a verified supplier
Bioz Manufacturer Symbol Boster Bio manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Boster Bio pcsk9
    Full fabrication and application schematic diagram of <t>GelMA-VEGF/ECM-PCSK9</t> composite hydrogel and the related signaling pathway of PCSK9 that promotes BMSC osteogenic differentiation.
    Pcsk9, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcsk9/Human+PCSK9+ELISA+Kit+EZ-Set/pmc13019078-69-6-10
    Average 94 stars, based on 2 article reviews
    pcsk9 - by Bioz Stars, 2026-08
    94/100 stars

    Images

    1) Product Images from "A composite hydrogel enables the spatiotemporal delivery of distinct cytokines to drive the native vascularized bone regeneration"

    Article Title: A composite hydrogel enables the spatiotemporal delivery of distinct cytokines to drive the native vascularized bone regeneration

    Journal: Bioactive Materials

    doi: 10.1016/j.bioactmat.2026.02.048

    Full fabrication and application schematic diagram of GelMA-VEGF/ECM-PCSK9 composite hydrogel and the related signaling pathway of PCSK9 that promotes BMSC osteogenic differentiation.
    Figure Legend Snippet: Full fabrication and application schematic diagram of GelMA-VEGF/ECM-PCSK9 composite hydrogel and the related signaling pathway of PCSK9 that promotes BMSC osteogenic differentiation.

    Techniques Used:

    Construction and characterization of GelMA-VEGF/ECM-PCSK9 composite hydrogel. A Schematic diagram showing the process of composite hydrogel construction; B) Photographs of GelMA-VEGF hydrogel and GelMA-VEGF/ECM-PCSK9 hydrogel formation after UV light respectively; C i) Electron microscopic image of pure GelMA hydrogel, with a scale of 100 μm; ii) Enlarged electron microscopic image of GelMA hydrogel, with a scale of 50 μm; D) i The electron microscope image of the combination of GelMA hydrogel and ECM, with a scale of 100 μm; ii Electron microscope magnified image of GelMA hydrogel combined with ECM, with a scale of 50 μm; E) The infrared spectrum (FITR) diagram of the acellular ECM, GelMA hydrogel and GelMA/ECM composite hydrogel contains common basic energy groups; F) Load rate of PCSK9 in ECM; G) Release rate of VEGF loaded with GelMA hydrogel and GelMA/ECM composite hydrogel respectively; H) Release rate of PCSK9 loaded with ECM and GelMA/ECM composite hydrogel respectively; I) Release rate of VEGF and PCSK9 loaded in GelMA and GelMA/ECM on different time points respectively; J) Release rate of VEGF and PCSK9 respectively when loaded in GelMA/ECM; K) The swelling rate of GelMA gel and GelMA/ECM composite gel dissolved in PBS (n = 6); L) Degradation rate of GelMA hydrogel and GelMA/ECM composite gel in vitro (n = 6).∗means that compared with the control group, p < 0.05; ∗means that compared with the control group, p < 0.01; ∗∗∗means that compared with the control group, p < 0.001.
    Figure Legend Snippet: Construction and characterization of GelMA-VEGF/ECM-PCSK9 composite hydrogel. A Schematic diagram showing the process of composite hydrogel construction; B) Photographs of GelMA-VEGF hydrogel and GelMA-VEGF/ECM-PCSK9 hydrogel formation after UV light respectively; C i) Electron microscopic image of pure GelMA hydrogel, with a scale of 100 μm; ii) Enlarged electron microscopic image of GelMA hydrogel, with a scale of 50 μm; D) i The electron microscope image of the combination of GelMA hydrogel and ECM, with a scale of 100 μm; ii Electron microscope magnified image of GelMA hydrogel combined with ECM, with a scale of 50 μm; E) The infrared spectrum (FITR) diagram of the acellular ECM, GelMA hydrogel and GelMA/ECM composite hydrogel contains common basic energy groups; F) Load rate of PCSK9 in ECM; G) Release rate of VEGF loaded with GelMA hydrogel and GelMA/ECM composite hydrogel respectively; H) Release rate of PCSK9 loaded with ECM and GelMA/ECM composite hydrogel respectively; I) Release rate of VEGF and PCSK9 loaded in GelMA and GelMA/ECM on different time points respectively; J) Release rate of VEGF and PCSK9 respectively when loaded in GelMA/ECM; K) The swelling rate of GelMA gel and GelMA/ECM composite gel dissolved in PBS (n = 6); L) Degradation rate of GelMA hydrogel and GelMA/ECM composite gel in vitro (n = 6).∗means that compared with the control group, p < 0.05; ∗means that compared with the control group, p < 0.01; ∗∗∗means that compared with the control group, p < 0.001.

    Techniques Used: Microscopy, In Vitro, Control

    Angiogenic capacity formulations of HUVECs in response to different composite biomaterial in vitro. A) Calcein/PI staining of HUVECs seeded on glass slides, showing the cell migration profiles of HUVECs treated with different material groups, scale bar = 200 μm; B) Quantitative analysis of the intercellular blank areas in each group, with the baseline group serving as the negative control; C) Angiogenic images of HUVECs co-cultured with different composite materials for 4 h and 8 h respectively, scale bar = 250 μm; D–G) Quantitative assessment of angiogenic capacity in each group via ImageJ software analysis of key angiogenic parameters. Abbreviations: NC = negative control group; V = exogenous VEGF protein-only group; GV=GelMA + exogenous VEGF protein group; GVE = GelMA + VEGF + ECM group; GVEP= GelMA/VEGF + ECM/PCSK9 group. Statistical notations: ∗∗means that compared with the control group, p < 0.01; ns = no significant difference between group.
    Figure Legend Snippet: Angiogenic capacity formulations of HUVECs in response to different composite biomaterial in vitro. A) Calcein/PI staining of HUVECs seeded on glass slides, showing the cell migration profiles of HUVECs treated with different material groups, scale bar = 200 μm; B) Quantitative analysis of the intercellular blank areas in each group, with the baseline group serving as the negative control; C) Angiogenic images of HUVECs co-cultured with different composite materials for 4 h and 8 h respectively, scale bar = 250 μm; D–G) Quantitative assessment of angiogenic capacity in each group via ImageJ software analysis of key angiogenic parameters. Abbreviations: NC = negative control group; V = exogenous VEGF protein-only group; GV=GelMA + exogenous VEGF protein group; GVE = GelMA + VEGF + ECM group; GVEP= GelMA/VEGF + ECM/PCSK9 group. Statistical notations: ∗∗means that compared with the control group, p < 0.01; ns = no significant difference between group.

    Techniques Used: In Vitro, Staining, Migration, Negative Control, Cell Culture, Software, Control

    The effect of different composite hydrogel on the osteogenic differentiation of BMMSC in vitro. Cultivate BMMSC for osteogenic differentiation in osteogenic medium with GelMA, GelMA-VEGF, GelMA-VEGF/ECM, ECM-PCSK9, and GelMA-VEGF/ECM-PCSK9 for 7 days respectively. A,B) The cell nucleus was stained with DAPI (blue), RUNX2 was stained with RUNX2 antibody (green), and COL1A1 was stained with COL1A1 antibody (red), with a scale bar of 200 μm. C,D) The quantitative analysis results of COL1A1 and RUNX2 immunofluorescence images; E,F) Quantitative analysis of ALP staining and ARS staining for BMMSC co-culture with different kinds of hydrogels; G) ALP staining result for BMMSC co-culture with different kinds of hydrogels for 7days, scale bar = 200 μm; F) ARS staining result for BMMSC co-culture with different kinds of hydrogels for 14days, scale bar = 200 μm; I, J) After 7 and 14 days of co-culture with different combinations of composite hydrogels and BMMSC for osteogenesis and differentiation, the PCR experiment results of osteogenesis related indicators suggest that compared with the control group. G = simple GelMA hydrogel group, GV=GelMA hydrogels + VEGF protein group, GV/E = GelMA + VEGF/ECM group, EP = ECM + PCSK9 protein group, GVEP=GelMA + VEGF/ECM + PCSK9 protein group, the significant differences between the groups are expressed as ∗ p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, and ns means there is no significant difference between the groups.
    Figure Legend Snippet: The effect of different composite hydrogel on the osteogenic differentiation of BMMSC in vitro. Cultivate BMMSC for osteogenic differentiation in osteogenic medium with GelMA, GelMA-VEGF, GelMA-VEGF/ECM, ECM-PCSK9, and GelMA-VEGF/ECM-PCSK9 for 7 days respectively. A,B) The cell nucleus was stained with DAPI (blue), RUNX2 was stained with RUNX2 antibody (green), and COL1A1 was stained with COL1A1 antibody (red), with a scale bar of 200 μm. C,D) The quantitative analysis results of COL1A1 and RUNX2 immunofluorescence images; E,F) Quantitative analysis of ALP staining and ARS staining for BMMSC co-culture with different kinds of hydrogels; G) ALP staining result for BMMSC co-culture with different kinds of hydrogels for 7days, scale bar = 200 μm; F) ARS staining result for BMMSC co-culture with different kinds of hydrogels for 14days, scale bar = 200 μm; I, J) After 7 and 14 days of co-culture with different combinations of composite hydrogels and BMMSC for osteogenesis and differentiation, the PCR experiment results of osteogenesis related indicators suggest that compared with the control group. G = simple GelMA hydrogel group, GV=GelMA hydrogels + VEGF protein group, GV/E = GelMA + VEGF/ECM group, EP = ECM + PCSK9 protein group, GVEP=GelMA + VEGF/ECM + PCSK9 protein group, the significant differences between the groups are expressed as ∗ p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, and ns means there is no significant difference between the groups.

    Techniques Used: In Vitro, Staining, Immunofluorescence, Co-Culture Assay, Control

    After adding different concentrations of PCSK9 to BMMSC for osteogenic induction, western blotting (WB) experiment was performed to evaluate the expression of phosphorylated proteins and total proteins among different osteogenic differentiation relevant signaling pathways. A) WB images of different signaling pathways that related to osteogenic differentiation after adding different concentrations of PCSK9; B-D) Quantitative analysis results of phosphorylated protein and total protein. Compared with the control group, ∗ means p < 0.05, ∗∗ means p < 0.01.
    Figure Legend Snippet: After adding different concentrations of PCSK9 to BMMSC for osteogenic induction, western blotting (WB) experiment was performed to evaluate the expression of phosphorylated proteins and total proteins among different osteogenic differentiation relevant signaling pathways. A) WB images of different signaling pathways that related to osteogenic differentiation after adding different concentrations of PCSK9; B-D) Quantitative analysis results of phosphorylated protein and total protein. Compared with the control group, ∗ means p < 0.05, ∗∗ means p < 0.01.

    Techniques Used: Western Blot, Expressing, Protein-Protein interactions, Control



    Similar Products

    94
    Sino Biological pcsk9 his
    Pcsk9 His, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcsk9/Human+PCSK9+%2F+NARC1+Protein/us12612403-748-1-2
    Average 94 stars, based on 1 article reviews
    pcsk9 his - by Bioz Stars, 2026-08
    94/100 stars
      Buy from Supplier

    94
    Multi Sciences (Lianke) Biotech Co Ltd human proprotein convertase 9 pcsk9 elisa kit
    Human Proprotein Convertase 9 Pcsk9 Elisa Kit, supplied by Multi Sciences (Lianke) Biotech Co Ltd, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcsk9/Human+Proprotein+Convertase+9%2FPCSK9+ELISA+Kit/pmc13130644-66-0-7
    Average 94 stars, based on 1 article reviews
    human proprotein convertase 9 pcsk9 elisa kit - by Bioz Stars, 2026-08
    94/100 stars
      Buy from Supplier

    95
    R&D Systems elisa human proprotein convertase 9 pcsk9 quantikine elisa kit
    Elisa Human Proprotein Convertase 9 Pcsk9 Quantikine Elisa Kit, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcsk9/Human+Proprotein+Convertase+9%2FPCSK9+Quantikine+ELISA+Kit/pmc13091390-93-23-31
    Average 95 stars, based on 1 article reviews
    elisa human proprotein convertase 9 pcsk9 quantikine elisa kit - by Bioz Stars, 2026-08
    95/100 stars
      Buy from Supplier

    94
    Boster Bio pcsk9
    Full fabrication and application schematic diagram of <t>GelMA-VEGF/ECM-PCSK9</t> composite hydrogel and the related signaling pathway of PCSK9 that promotes BMSC osteogenic differentiation.
    Pcsk9, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcsk9/Human+PCSK9+ELISA+Kit+EZ-Set/pmc13019078-69-6-10
    Average 94 stars, based on 1 article reviews
    pcsk9 - by Bioz Stars, 2026-08
    94/100 stars
      Buy from Supplier

    86
    Novartis pcsk9 inhibitors
    Full fabrication and application schematic diagram of <t>GelMA-VEGF/ECM-PCSK9</t> composite hydrogel and the related signaling pathway of PCSK9 that promotes BMSC osteogenic differentiation.
    Pcsk9 Inhibitors, supplied by Novartis, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcsk9/inhibitors+pcsk9/pm42258745-416-14-16
    Average 86 stars, based on 1 article reviews
    pcsk9 inhibitors - by Bioz Stars, 2026-08
    86/100 stars
      Buy from Supplier

    86
    Ipsen Group pcsk9
    Full fabrication and application schematic diagram of <t>GelMA-VEGF/ECM-PCSK9</t> composite hydrogel and the related signaling pathway of PCSK9 that promotes BMSC osteogenic differentiation.
    Pcsk9, supplied by Ipsen Group, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcsk9/pcsk9/pm42287816-293-4-14
    Average 86 stars, based on 1 article reviews
    pcsk9 - by Bioz Stars, 2026-08
    86/100 stars
      Buy from Supplier

    86
    Synthego Inc sgrna targeting mouse pcsk9 cccauaccuuggagcaacgg
    Full fabrication and application schematic diagram of <t>GelMA-VEGF/ECM-PCSK9</t> composite hydrogel and the related signaling pathway of PCSK9 that promotes BMSC osteogenic differentiation.
    Sgrna Targeting Mouse Pcsk9 Cccauaccuuggagcaacgg, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcsk9/cacuggaagagcaauggcug+gene+grna+mouse+targeting+trim32/pm42190011-200-1-13
    Average 86 stars, based on 1 article reviews
    sgrna targeting mouse pcsk9 cccauaccuuggagcaacgg - by Bioz Stars, 2026-08
    86/100 stars
      Buy from Supplier

    86
    Sanofi pcsk9 inhibitor mab
    Full fabrication and application schematic diagram of <t>GelMA-VEGF/ECM-PCSK9</t> composite hydrogel and the related signaling pathway of PCSK9 that promotes BMSC osteogenic differentiation.
    Pcsk9 Inhibitor Mab, supplied by Sanofi, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcsk9/alirocumab+inhibitor+pcsk9+s+sanofi/pm42099287-38-24-44
    Average 86 stars, based on 1 article reviews
    pcsk9 inhibitor mab - by Bioz Stars, 2026-08
    86/100 stars
      Buy from Supplier

    86
    Sanofi sanofi s pcsk9 inhibitor alirocumab
    Full fabrication and application schematic diagram of <t>GelMA-VEGF/ECM-PCSK9</t> composite hydrogel and the related signaling pathway of PCSK9 that promotes BMSC osteogenic differentiation.
    Sanofi S Pcsk9 Inhibitor Alirocumab, supplied by Sanofi, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcsk9/alirocumab+inhibitor+pcsk9+s+sanofi/pm42102977-573-3-3
    Average 86 stars, based on 1 article reviews
    sanofi s pcsk9 inhibitor alirocumab - by Bioz Stars, 2026-08
    86/100 stars
      Buy from Supplier

    95
    R&D Systems pcsk9
    Full fabrication and application schematic diagram of <t>GelMA-VEGF/ECM-PCSK9</t> composite hydrogel and the related signaling pathway of PCSK9 that promotes BMSC osteogenic differentiation.
    Pcsk9, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcsk9/Human+Proprotein+Convertase+9%2FPCSK9+Quantikine+ELISA+Kit/us12605451-1548-3-19
    Average 95 stars, based on 1 article reviews
    pcsk9 - by Bioz Stars, 2026-08
    95/100 stars
      Buy from Supplier

    Image Search Results


    Full fabrication and application schematic diagram of GelMA-VEGF/ECM-PCSK9 composite hydrogel and the related signaling pathway of PCSK9 that promotes BMSC osteogenic differentiation.

    Journal: Bioactive Materials

    Article Title: A composite hydrogel enables the spatiotemporal delivery of distinct cytokines to drive the native vascularized bone regeneration

    doi: 10.1016/j.bioactmat.2026.02.048

    Figure Lengend Snippet: Full fabrication and application schematic diagram of GelMA-VEGF/ECM-PCSK9 composite hydrogel and the related signaling pathway of PCSK9 that promotes BMSC osteogenic differentiation.

    Article Snippet: VEGF, ELISA kit for VEGF and PCSK9 were purchased from Boster company (Wuhan, China).

    Techniques:

    Construction and characterization of GelMA-VEGF/ECM-PCSK9 composite hydrogel. A Schematic diagram showing the process of composite hydrogel construction; B) Photographs of GelMA-VEGF hydrogel and GelMA-VEGF/ECM-PCSK9 hydrogel formation after UV light respectively; C i) Electron microscopic image of pure GelMA hydrogel, with a scale of 100 μm; ii) Enlarged electron microscopic image of GelMA hydrogel, with a scale of 50 μm; D) i The electron microscope image of the combination of GelMA hydrogel and ECM, with a scale of 100 μm; ii Electron microscope magnified image of GelMA hydrogel combined with ECM, with a scale of 50 μm; E) The infrared spectrum (FITR) diagram of the acellular ECM, GelMA hydrogel and GelMA/ECM composite hydrogel contains common basic energy groups; F) Load rate of PCSK9 in ECM; G) Release rate of VEGF loaded with GelMA hydrogel and GelMA/ECM composite hydrogel respectively; H) Release rate of PCSK9 loaded with ECM and GelMA/ECM composite hydrogel respectively; I) Release rate of VEGF and PCSK9 loaded in GelMA and GelMA/ECM on different time points respectively; J) Release rate of VEGF and PCSK9 respectively when loaded in GelMA/ECM; K) The swelling rate of GelMA gel and GelMA/ECM composite gel dissolved in PBS (n = 6); L) Degradation rate of GelMA hydrogel and GelMA/ECM composite gel in vitro (n = 6).∗means that compared with the control group, p < 0.05; ∗means that compared with the control group, p < 0.01; ∗∗∗means that compared with the control group, p < 0.001.

    Journal: Bioactive Materials

    Article Title: A composite hydrogel enables the spatiotemporal delivery of distinct cytokines to drive the native vascularized bone regeneration

    doi: 10.1016/j.bioactmat.2026.02.048

    Figure Lengend Snippet: Construction and characterization of GelMA-VEGF/ECM-PCSK9 composite hydrogel. A Schematic diagram showing the process of composite hydrogel construction; B) Photographs of GelMA-VEGF hydrogel and GelMA-VEGF/ECM-PCSK9 hydrogel formation after UV light respectively; C i) Electron microscopic image of pure GelMA hydrogel, with a scale of 100 μm; ii) Enlarged electron microscopic image of GelMA hydrogel, with a scale of 50 μm; D) i The electron microscope image of the combination of GelMA hydrogel and ECM, with a scale of 100 μm; ii Electron microscope magnified image of GelMA hydrogel combined with ECM, with a scale of 50 μm; E) The infrared spectrum (FITR) diagram of the acellular ECM, GelMA hydrogel and GelMA/ECM composite hydrogel contains common basic energy groups; F) Load rate of PCSK9 in ECM; G) Release rate of VEGF loaded with GelMA hydrogel and GelMA/ECM composite hydrogel respectively; H) Release rate of PCSK9 loaded with ECM and GelMA/ECM composite hydrogel respectively; I) Release rate of VEGF and PCSK9 loaded in GelMA and GelMA/ECM on different time points respectively; J) Release rate of VEGF and PCSK9 respectively when loaded in GelMA/ECM; K) The swelling rate of GelMA gel and GelMA/ECM composite gel dissolved in PBS (n = 6); L) Degradation rate of GelMA hydrogel and GelMA/ECM composite gel in vitro (n = 6).∗means that compared with the control group, p < 0.05; ∗means that compared with the control group, p < 0.01; ∗∗∗means that compared with the control group, p < 0.001.

    Article Snippet: VEGF, ELISA kit for VEGF and PCSK9 were purchased from Boster company (Wuhan, China).

    Techniques: Microscopy, In Vitro, Control

    Angiogenic capacity formulations of HUVECs in response to different composite biomaterial in vitro. A) Calcein/PI staining of HUVECs seeded on glass slides, showing the cell migration profiles of HUVECs treated with different material groups, scale bar = 200 μm; B) Quantitative analysis of the intercellular blank areas in each group, with the baseline group serving as the negative control; C) Angiogenic images of HUVECs co-cultured with different composite materials for 4 h and 8 h respectively, scale bar = 250 μm; D–G) Quantitative assessment of angiogenic capacity in each group via ImageJ software analysis of key angiogenic parameters. Abbreviations: NC = negative control group; V = exogenous VEGF protein-only group; GV=GelMA + exogenous VEGF protein group; GVE = GelMA + VEGF + ECM group; GVEP= GelMA/VEGF + ECM/PCSK9 group. Statistical notations: ∗∗means that compared with the control group, p < 0.01; ns = no significant difference between group.

    Journal: Bioactive Materials

    Article Title: A composite hydrogel enables the spatiotemporal delivery of distinct cytokines to drive the native vascularized bone regeneration

    doi: 10.1016/j.bioactmat.2026.02.048

    Figure Lengend Snippet: Angiogenic capacity formulations of HUVECs in response to different composite biomaterial in vitro. A) Calcein/PI staining of HUVECs seeded on glass slides, showing the cell migration profiles of HUVECs treated with different material groups, scale bar = 200 μm; B) Quantitative analysis of the intercellular blank areas in each group, with the baseline group serving as the negative control; C) Angiogenic images of HUVECs co-cultured with different composite materials for 4 h and 8 h respectively, scale bar = 250 μm; D–G) Quantitative assessment of angiogenic capacity in each group via ImageJ software analysis of key angiogenic parameters. Abbreviations: NC = negative control group; V = exogenous VEGF protein-only group; GV=GelMA + exogenous VEGF protein group; GVE = GelMA + VEGF + ECM group; GVEP= GelMA/VEGF + ECM/PCSK9 group. Statistical notations: ∗∗means that compared with the control group, p < 0.01; ns = no significant difference between group.

    Article Snippet: VEGF, ELISA kit for VEGF and PCSK9 were purchased from Boster company (Wuhan, China).

    Techniques: In Vitro, Staining, Migration, Negative Control, Cell Culture, Software, Control

    The effect of different composite hydrogel on the osteogenic differentiation of BMMSC in vitro. Cultivate BMMSC for osteogenic differentiation in osteogenic medium with GelMA, GelMA-VEGF, GelMA-VEGF/ECM, ECM-PCSK9, and GelMA-VEGF/ECM-PCSK9 for 7 days respectively. A,B) The cell nucleus was stained with DAPI (blue), RUNX2 was stained with RUNX2 antibody (green), and COL1A1 was stained with COL1A1 antibody (red), with a scale bar of 200 μm. C,D) The quantitative analysis results of COL1A1 and RUNX2 immunofluorescence images; E,F) Quantitative analysis of ALP staining and ARS staining for BMMSC co-culture with different kinds of hydrogels; G) ALP staining result for BMMSC co-culture with different kinds of hydrogels for 7days, scale bar = 200 μm; F) ARS staining result for BMMSC co-culture with different kinds of hydrogels for 14days, scale bar = 200 μm; I, J) After 7 and 14 days of co-culture with different combinations of composite hydrogels and BMMSC for osteogenesis and differentiation, the PCR experiment results of osteogenesis related indicators suggest that compared with the control group. G = simple GelMA hydrogel group, GV=GelMA hydrogels + VEGF protein group, GV/E = GelMA + VEGF/ECM group, EP = ECM + PCSK9 protein group, GVEP=GelMA + VEGF/ECM + PCSK9 protein group, the significant differences between the groups are expressed as ∗ p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, and ns means there is no significant difference between the groups.

    Journal: Bioactive Materials

    Article Title: A composite hydrogel enables the spatiotemporal delivery of distinct cytokines to drive the native vascularized bone regeneration

    doi: 10.1016/j.bioactmat.2026.02.048

    Figure Lengend Snippet: The effect of different composite hydrogel on the osteogenic differentiation of BMMSC in vitro. Cultivate BMMSC for osteogenic differentiation in osteogenic medium with GelMA, GelMA-VEGF, GelMA-VEGF/ECM, ECM-PCSK9, and GelMA-VEGF/ECM-PCSK9 for 7 days respectively. A,B) The cell nucleus was stained with DAPI (blue), RUNX2 was stained with RUNX2 antibody (green), and COL1A1 was stained with COL1A1 antibody (red), with a scale bar of 200 μm. C,D) The quantitative analysis results of COL1A1 and RUNX2 immunofluorescence images; E,F) Quantitative analysis of ALP staining and ARS staining for BMMSC co-culture with different kinds of hydrogels; G) ALP staining result for BMMSC co-culture with different kinds of hydrogels for 7days, scale bar = 200 μm; F) ARS staining result for BMMSC co-culture with different kinds of hydrogels for 14days, scale bar = 200 μm; I, J) After 7 and 14 days of co-culture with different combinations of composite hydrogels and BMMSC for osteogenesis and differentiation, the PCR experiment results of osteogenesis related indicators suggest that compared with the control group. G = simple GelMA hydrogel group, GV=GelMA hydrogels + VEGF protein group, GV/E = GelMA + VEGF/ECM group, EP = ECM + PCSK9 protein group, GVEP=GelMA + VEGF/ECM + PCSK9 protein group, the significant differences between the groups are expressed as ∗ p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, and ns means there is no significant difference between the groups.

    Article Snippet: VEGF, ELISA kit for VEGF and PCSK9 were purchased from Boster company (Wuhan, China).

    Techniques: In Vitro, Staining, Immunofluorescence, Co-Culture Assay, Control

    After adding different concentrations of PCSK9 to BMMSC for osteogenic induction, western blotting (WB) experiment was performed to evaluate the expression of phosphorylated proteins and total proteins among different osteogenic differentiation relevant signaling pathways. A) WB images of different signaling pathways that related to osteogenic differentiation after adding different concentrations of PCSK9; B-D) Quantitative analysis results of phosphorylated protein and total protein. Compared with the control group, ∗ means p < 0.05, ∗∗ means p < 0.01.

    Journal: Bioactive Materials

    Article Title: A composite hydrogel enables the spatiotemporal delivery of distinct cytokines to drive the native vascularized bone regeneration

    doi: 10.1016/j.bioactmat.2026.02.048

    Figure Lengend Snippet: After adding different concentrations of PCSK9 to BMMSC for osteogenic induction, western blotting (WB) experiment was performed to evaluate the expression of phosphorylated proteins and total proteins among different osteogenic differentiation relevant signaling pathways. A) WB images of different signaling pathways that related to osteogenic differentiation after adding different concentrations of PCSK9; B-D) Quantitative analysis results of phosphorylated protein and total protein. Compared with the control group, ∗ means p < 0.05, ∗∗ means p < 0.01.

    Article Snippet: VEGF, ELISA kit for VEGF and PCSK9 were purchased from Boster company (Wuhan, China).

    Techniques: Western Blot, Expressing, Protein-Protein interactions, Control